rs4456042 chrX:13092648 C>G
- Sequence
aggccagggatgctgttaaatatc[C/G]tacaacgcacagcacagctcctgc
- ASB in cell types
- neutrophils from periferal blood GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -0.21 | 3.08 | 2.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.20 | 1.31 | 1.00 |
Items per page:
1 – 2 of 2