rs4457256 chr7:131655046 C>T
- Sequence
ggtcggatttcaggtttccctaaa[C/T]gtctcagcgtgaatgggagtgaag
- ASB in cell types
- K562 (myelogenous leukemia) MM1.S (plasma cell myeloma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.43 | -0.04 | 1.50 | |||
| MM1.S (plasma cell myeloma) | -0.79 | 1.84 | 2.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.23 | 1.48 | 2.00 |
Items per page:
1 – 3 of 3