rs4459399 chr12:31923161 T>A
- Sequence
ttcctttgtttgaaagaattctac[T/A]gagcacctgccctaaccgccttcc
- ASB in cell types
- CD34+ hematopoietic stem cells MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells | 1.68 | n/a | 2.00 | |||
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 1.47 | -0.04 | 1.00 |
Items per page:
1 – 2 of 2