rs4459686 chr2:237677999 C>T
- Sequence
cttgttaatactctgagtccattg[C/T]gtcacctcgggcggaccatttccc
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 1.76 | 0.10 | 1.20 | -5.30 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP antidepressant efficacy in major depressive disorder remission after 12 weeks of treatment, fasting blood glucose, major depressive disorder, mitral annular calcium
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Pancreas, Pituitary, Whole_Blood