rs4461636 chr5:19885107 T>G
- Sequence
ccttccatattatgggcgaaaaat[T/G]atttcaaaattagataactttgtg
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | n/a | 3.06 | 2.00 | n/a | No Hit | |||
| GCR_HUMAN | n/a | 2.48 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-ir, ldl cholesterol, mitral annular calcium, nicotine dependence (smoking), normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes, obesity with early age of onset (age >2), rheumatoid arthritis