rs4461916 chr8:20436915 A>G
- Sequence
ctgctgatcctcttatttgacaat[A/G]cctaagaaacacctacatcttcct
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -1.86 | 2.64 | 1.50 | |||
| macrophages form periferal blood | -2.15 | 2.95 | 2.00 |
Items per page:
1 – 2 of 2