rs4462847 chr20:24918423 T>G
- Sequence
aggggggcgggggcgctgccaagg[T/G]ctcacagctgaagagggaagccag
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 0.70 | -0.16 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 1.24 | -1.24 | 1.00 | |||
| neural cell | -0.51 | 0.69 | 1.00 |
Items per page:
1 – 3 of 3