rs4468361 chr11:132140223 T>C
- Sequence
tcagacttcagaccctattctctt[T/C]gctctcccggagcctctctctgac
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 2.98 | n/a | 1.00 |
Items per page:
1 – 1 of 1