rs4469413 chr8:91253410 A>G
- Sequence
gtagtcttgtttcatgggccctgc[A/G]gtcgctgtaattctgtctgaacta
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.63 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP primary rhegmatogenous retinal detachment, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)
GTEx eQTL Artery_Aorta, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis