rs4469792 chr10:12246781 A>G
- Sequence
gaacccactgatgagaattccctc[A/G]gttgatttctcatcacacctacaa
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.87 | -4.33 | 2.00 | -0.56 | Weak Concordant | |||
| GCR_HUMAN | 1.08 | 0.61 | 1.41 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP bipolar disorder, college completion, coronary artery disease (cad), lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood