rs45470795 chr14:20782562 C>T
- Sequence
aagtccctagaaaacttttgaggc[C/T]tccctggggccccacttccttgcc
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -0.02 | 1.12 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Lung, Nerve_Tibial, Whole_Blood