rs45482297 chr6:35297758 G>A
- Sequence
aatgtgcaggcaggtggtgctctc[G/A]ctccaccacggcacctctgcggtc
- ASB in cell types
- neutrophils from periferal blood pancreas Peyer's patch 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.50 | -0.33 | 1.50 | |||
| pancreas | 0.99 | -0.99 | 1.00 | |||
| Peyer's patch | 0.81 | -0.81 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.93 | -5.44 | 2.00 | |||
| MDA-MB-157 (triple negative breast carcinoma) | 1.56 | -3.80 | 2.00 |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood