rs45486593 chr10:58385442 C>T
- Sequence
tcgctagtggcgggcatgataaca[C/T]acgccggagggtcgcacgcgggtt
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.90 | 1.68 | 1.33 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -3.01 | 1.84 | 1.33 |
Items per page:
1 – 2 of 2