rs45491397 chr1:9267285 G>T
- Sequence
ggtggaagttccacagctggccgc[G/T]tgggggggcccttgcaccgcactg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) neutrophils from periferal blood
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.75 | 1.29 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Thyroid