rs45493300 chr6:35497803 A>G
- Sequence
ggcaggagtgggacgggggttgag[A/G]cttccagctcgcgcctcggacgcc
- ASB in cell types
- HepG2 (hepatoblastoma) HCC1806(Squamous cell breast carcinoma, acantholytic variant)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.93 | -0.04 | 2.00 | |||
| HCC1806(Squamous cell breast carcinoma, acantholytic variant) | 2.30 | -1.33 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Lung