rs45527542 chr10:95290993 G>A
- Sequence
aacagcttgcagggcacccccggc[G/A]gctgtcggagaaagagcggcgcgg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.98 | -4.12 | 3.00 | 1.22 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
