rs45529133 chr1:11791162 C>T
- Sequence
ggacttggtcccaatccctcccca[C/T]ggttttccaggtgggcggggcaag
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HKC8 (kidney proximal tubule cell line) | -0.20 | 1.08 | 1.00 | |||
| MDM(monocyte derived macrophages) | 2.31 | n/a | 3.00 |
Items per page:
1 – 2 of 2