rs45558633 chr20:63981221 C>T
- Sequence
ttccgctgcctcattcctttcctt[C/T]ctagccttggtcgtcgccgccacc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) breast tumor GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TYY1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.83 | n/a | 1.50 | n/a | No Hit | |||
| ESR1_HUMAN | 2.50 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood