rs45564932 chr20:38435418 A>C
- Sequence
tgcggcctagagcggtaggaaccg[A/C]cgcgagcagtcctgcagcgtcccc
- ASB in cell types
- RCC 7860 (Renal cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RCC 7860 (Renal cell carcinoma) | 1.88 | 0.48 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid