rs4657055 chr1:161524102 T>C
- Sequence
cgcatggtaacatatcttcggcct[T/C]cctgagccgctgggctctcagcgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney) HEK293T (embryonic kidney) HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- KDM2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | 2.63 | -4.96 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, homa-ir, ldl cholesterol, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood