rs4760278 chr12:57377370 C>A
- Sequence
caactagagttcactctgaaggag[C/A]gtcatcacagcctgaattgccacc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- FOXM1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXM1_HUMAN | 2.65 | -4.88 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, fasting blood glucose, hdl cholesterol, ldl cholesterol, microalbuminuria, obesity with early age of onset (age >2), serum creatinine, serum urate, total cholesterol, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid