rs4761429 chr12:76559119 G>A
- Sequence
aaacttcaggagggacagacaccc[G/A]gggcggtcgaaatgctccaacagc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.05 | 0.89 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.40 | 0.70 | 1.10 |
Items per page:
1 – 2 of 2