rs4761624 chr12:94532979 C>T
- Sequence
acagtggcgtgtgcattctcattc[C/T]tggacaaactctgccccctggcgc
- ASB in cell types
- WA09 (embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line) erythroid progenitors
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.98 | 0.42 | 1.21 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alzheimers disease, arthritis including non-rheumatoid, cystatin c in serum, hdl cholesterol, longstanding arthritis, partial epilepsy, prop taste detection threshold, schizophrenia