rs4761798 chr12:52473930 C>T
- Sequence
caaatagtgagatcacacctggat[C/T]agaaaagttatgaaatgctgagat
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | -1.06 | 1.06 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, rheumatoid arthritis, tardive dyskinesia, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Colon_Transverse, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg