rs4761814 chr12:51262837 A>G
- Sequence
gaggcatcagatcttttgccacct[A/G]agtctgccagcctacttatttgct
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts GM18951 (B-cells Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma) KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.66 | 1.62 | 1.82 | n/a | No Hit | |||
| GATA1_HUMAN | n/a | 2.82 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Cells_Cultured_fibroblasts, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Whole_Blood