rs4761872 chr12:52391107 C>T
- Sequence
ccagcacccattgcagggctgacc[C/T]cagaagacactcaggaggtgtttg
- ASB in cell types
- epithelial cell of prostate Peyer's patch foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.59 | 1.59 | 1.00 | |||
| Peyer's patch | -2.69 | 2.77 | 1.00 | |||
| foreskin keratinocyte | 0.83 | n/a | 1.83 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Esophagus_Mucosa, Minor_Salivary_Gland, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid