rs4761966 chr12:51263185 C>T
- Sequence
tcacttgagatcagaagttcgaga[C/T]cagtctggccaacatggtgaaacc
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) renal cortex
- ASB for transcription factors
- JUND_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | -1.19 | 1.19 | 1.00 | n/a | No Hit | |||
| CREB1_HUMAN | -2.66 | 2.57 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Cells_Cultured_fibroblasts, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Whole_Blood