rs4762068 chr12:52198020 C>T
- Sequence
gtaaaaggccacccttcctcccag[C/T]gcccatgttacactggatttcaac
- ASB in cell types
- macrophages form periferal blood
- ASB for transcription factors
- ERG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERG_HUMAN | 2.33 | -2.17 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, alzheimers disease, schizophrenia, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood