rs4762107 chr12:65630579 A>G
- Sequence
actctatatttcctttggccagaa[A/G]tgatgtctcccttttctgaacttt
- ASB in cell types
- HEK293 (embryonic kidney) 22RV1 (prostate carcinoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMRC1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | -0.40 | 1.52 | 1.00 | n/a | n/a | |||
| ANDR_HUMAN | 0.04 | 2.01 | 1.61 | n/a | No Hit |
Items per page:
1 – 2 of 2