rs4766232 chr12:4320852 G>A
- Sequence
ttggtcgctgtacacccgtgaggg[G/A]ttcatcacagtggccagctataag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) LNCaP (prostate carcinoma)
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.94 | -0.18 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1