rs4766418 chr12:1791264 C>G
- Sequence
acttaggttccaagttcatgcgtc[C/G]gagagcaggtgatgggctttagag
- ASB in cell types
- neutrophils from periferal blood TMD8 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.27 | -4.64 | 1.50 | |||
| TMD8 (diffuse large B-cell lymphoma) | 2.41 | -1.65 | 2.00 |
Items per page:
1 – 2 of 2