rs4766566 chr12:111269073 C>T
- Sequence
ttcctgagctgcagtctcctcttc[C/T]ataaattgagaataatattagaac
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.17 | -2.16 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI atrial fibrillation, gout, platelet count, renal overload gout, renal underexcretion gout, serum uric acid levels
GRASP alcohol consumption, college completion, coronary artery disease (cad), cystatin c in serum, diastolic blood pressure (dbp), drinking behavior, ldl cholesterol, maternal transmission distortion, systolic blood pressure (sbp), total cholesterol, transmission distortion
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood