rs4768543 chr12:43915175 A>G
- Sequence
gttctcaaagtctaggtcttacct[A/G]taccccttggagggaggcttggcc
- ASB in cell types
- thyroid gland neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | n/a | 3.14 | 1.00 | |||
| neural cell | 1.93 | 0.14 | 1.00 |
Items per page:
1 – 2 of 2