rs4769531 chr13:26924261 A>G
- Sequence
agagaggtgtgagatcccgaggag[A/G]aaacaatttgaaagccctgcttct
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 0.24 | 1.10 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), barnes akathisia rating scale, birth weight, fasting blood glucose, hdl cholesterol change with statins, serum creatinine, triglycerides