rs4769586 chr13:27976531 G>A
- Sequence
ttaccaagcagcaagttattgtgt[G/A]tgtcaggaaatcccccaggttacc
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | -1.14 | 1.74 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Testis