rs4769607 chr13:28545760 C>T
- Sequence
gctacttcgcattctgttttatta[C/T]ctgtaaaatggagataacaatgtt
- ASB in cell types
- 22RV1 (prostate carcinoma) embryonic stem cells derived definitive endoderm
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -4.67 | 2.72 | 2.00 | |||
| embryonic stem cells derived definitive endoderm | 0.22 | 1.13 | 1.00 |
Items per page:
1 – 2 of 2