rs4770433 chr13:23329652 A>G

Sequence
taaaattacaacaaattcatgatc[A/G]gagccagctgatgagaaaataacg
ASB in cell types
BEAS-2B (bronchial epithelium)
ASB for transcription factors
GCR_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
GCR_HUMAN n/a 2.19 1.000.03 1.00 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI protein quantitative trait loci
GRASP adiponectin levels il12 irritible bowel syndrome neuroblastoma (brain cancer) partial epilepsy rheumatoid arthritis tetrology of fallot triglycerides waist hip ratio
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area abnormal kidney function abnormal papanicolaou smear of cervix and cervical hpv abnormal results of function studies actinic keratosis adverse drug events and drug allergies alopecia areata anterior pituitary disorders antisocial/borderline personality disorder ascvd attention deficit hyperactivity disorder back & neck sprains cardiac and circulatory congenital anomalies cardiac congenital anomalies cardiac shunt/ heart septal defect cellulitis and abscess of leg central/nonobstroctive sleep apnea colon cancer congenital anomalies of limbs congenital anomalies of lower limb, including pelvic girdle congenital pigmentary anomalies of skin dementia with cerebral degenerations dysphagia early or threatened labor hemorrhage in early pregnancy endometriosis epilepsy, recurrent seizures, convulsions fibroadenosis of breast genital prolapse gout and other crystal arthropathies hallux rigidus hemorrhage in early pregnancy hypertension complicating pregnancy inflammatory diseases of female pelvic organs iron deficiency anemias iron deficiency anemias nos left bundle branch block melanoma myasthenia gravis myoneural disorders obstruction of bile duct osteoarthrosis localized, secondary other alveolar and parietoalveolar pneumonopathy other disorders of pancreatic internal secretion other disorders of thyroid other specified disorders of pancreatic internal secretion other specified osteoporosis perforation of tympanic membrane pervasive developmental disorders phlebitis and thrombophlebitis prolapse of vaginal walls pruritus and related conditions rheumatic fever / chorea simple goiter sprains and strains torticollis ulcerative colitis unequal leg length (acquired) wheezing
GTEx eQTL Cells_Cultured_fibroblasts Muscle_Skeletal

Download