rs4771307 chr13:98569625 A>G
- Sequence
gtgctgggatgaatgagaagcatt[A/G]ccaaaagaaaagaaatctgatcag
- ASB in cell types
- HepG2 (hepatoblastoma) CD14+ monocytes SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.48 | -1.70 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, college completion, hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, refractive error, spine bone mineral density (bmd), total cholesterol, years of education
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood