rs4774992 chr15:57861558 A>T
- Sequence
tttcaaagaagctaaataattttc[A/T]taagtcaattttgtaacttgtttg
- ASB in cell types
- H929 (plasma cell myeloma) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.54 | -2.26 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -0.29 | 1.68 | 1.50 |
Items per page:
1 – 2 of 2