rs4775398 chr15:61381673 T>C
- Sequence
ctatttagctaatgtcttgttgac[T/C]atagttggcgtgtttgcaatgctt
- ASB in cell types
- endometrial stromal cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| endometrial stromal cells | 1.77 | -1.45 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, infant head circumference, late onset alzheimers disease, neuroblastoma (brain cancer), total cholesterol