rs4776219 chr15:54274125 C>T
- Sequence
tgatgctgaggctaacatcgtcaa[C/T]agggggagccagtcctagggaggt
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) HeLa S3 (cervical adenocarcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.90 | -1.30 | 1.33 | |||
| HeLa S3 (cervical adenocarcinoma) | -2.11 | 2.53 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.02 | 1.70 | 1.39 |
Items per page:
1 – 3 of 3