rs4776338 chr15:67067545 T>C
- Sequence
ccgcaaagggattgtcatccctgc[T/C]cctgggccagggtggactccatcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 2.11 | 0.12 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, birth weight, coronary artery disease (cad), paclitaxel-induced cytotoxicity in lymphoblastoid cell lines, urinary albumin-to-creatinine ratio