rs4776397 chr15:68361219 C>T
- Sequence
tgcattgcacaacatcagggggcg[C/T]cattcatatgtctaagtgaacaat
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.08 | -0.83 | 1.25 | -2.61 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol, ldl cholesterol change with statins, schizophrenia, sporadic creutzfeldt-jakob disease, total cholesterol, total cholesterol change with statins