rs4777048 chr15:68385238 G>T
- Sequence
tcagttctgtgatttcgaagccta[G/T]attctccctgtagtgaggagctac
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 0.55 | 1.65 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol change with statins, ldl cholesterol, ldl cholesterol change with statins, tardive dyskinesia, total cholesterol change with statins