rs4777221 chr15:70019393 A>G
- Sequence
cttatccttagatctagcctctgg[A/G]ttaaggatattcagaagattctgc
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | n/a | 2.91 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), irritible bowel syndrome, maternal transmission distortion, paternal transmission distortion, transmission distortion