rs4777288 chr15:70492724 C>G
- Sequence
gcttcctccctgctgctcagccca[C/G]tgcctgcctgcgtggacgcgtcct
- ASB in cell types
- HEK293 (embryonic kidney) HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | 1.90 | n/a | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hdl cholesterol change with statins, homa-b, mitral annular calcium, serum creatinine