rs4778818 chr15:80567759 G>A
- Sequence
cacggatcaggatgccccctcagg[G/A]cacagttacaccagaagcctcaat
- ASB in cell types
- vagina
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| vagina | 2.47 | -2.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, eye color, premature ovarian failure, primary rhegmatogenous retinal detachment, refractive error, tetrology of fallot, triglycerides change with statins