rs4779341 chr15:22223559 T>C
- Sequence
aaaggataatgatggctacacaca[T/C]gtccctaagctcactacctgggga
- ASB in cell types
- SYO-1(Biphasic synovial sarcoma) T47D (invasive ductal carcinoma) H929 (plasma cell myeloma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SYO-1(Biphasic synovial sarcoma) | 2.67 | -2.54 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 1.36 | -0.46 | 2.00 | |||
| H929 (plasma cell myeloma) | 2.36 | -2.38 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -2.83 | 1.75 | 1.50 |
Items per page:
1 – 4 of 4