rs4780441 chr16:12459252 C>T
- Sequence
aggttcctctcctgtggggctcac[C/T]agcagctctgagcttagatcctca
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.46 | -1.10 | 2.00 | |||
| MDM(monocyte derived macrophages) | 0.05 | 2.28 | 2.44 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.08 | 0.75 | 1.00 |
Items per page:
1 – 3 of 3