rs4782487 chr16:88975505 C>T
- Sequence
actgaggcccagggaggaagcacc[C/T]ggcccaaggccactcagcgccagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.22 | 0.83 | 1.17 | |||
| primary B-CLL cells | n/a | 2.88 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood